subject
Spanish, 09.03.2021 23:20 sofia3226

1. ¿Qué tiempo hace en el verano? a. hace frio b. hace calor c. nieva

2. ¿Qué tiempo hace en el invierno?

a. hace frio b. hace calor c. olas

Please help

I will give brainllest and 5 stars to the best answer

ansver
Answers: 3
Show answers

Other questions on the subject: Spanish

image
Spanish, 23.06.2019 02:00, macybarham
Which letter in the spanish alphabet is pronounced like the letter “e” in the english alphabet? a. e b. i c. v d. j
Answers: 2
continue
image
Spanish, 23.06.2019 04:50, nallwly
In english, cuidadoso means: nosy understanding careful
Answers: 2
continue
image
Spanish, 23.06.2019 11:40, joyelewis58
8. choose the answer that best completes the sentence. (entregar) el examen. (2 points) a: entregas b: entrega c: entrego d: entregan
Answers: 1
continue
image
Spanish, 23.06.2019 15:30, sierracupcake0220
Which word correctly completes this sentence? me encanta la ropa tradicional, es la y la más barata. a. buena b. mejor c. peor d. mala
Answers: 1
continue
You know the right answer?
1. ¿Qué tiempo hace en el verano? a. hace frio b. hace calor c. nieva

2. ¿Qué tiempo ha...

Questions in other subjects:

Konu
SAT, 29.12.2021 04:10
Compare the character of faustus at the beginning of the play with his character at the end. How have his character traits and basic ambitions shifted over the course of the play?...
Konu
Biology, 29.12.2021 04:10
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA...
Konu
SAT, 29.12.2021 04:10
A stone fell from the top of a cliff into the ocean. In the air, it had an average speed of 161616 \text{m/s}m/sstart text, m, slash, s, end text. In the water, it had an average s...
Konu
Mathematics, 29.12.2021 04:10
What is 18 1/5 -7 3/5 as a mixed number in simplest form...
Konu
SAT, 29.12.2021 04:10
What are the typical sources of data which is used for data analytics....
Konu
Chemistry, 29.12.2021 04:10
Which of these describes a human activity that uses up a non-renewable resource? building new roads that cause topsoil to erode chopping down trees from the forest fo...
Konu
SAT, 29.12.2021 04:10
Which general trends in atomic radius and electronegativity are observed....
Konu
Health, 29.12.2021 04:10
a couple undergoes a workup for infertility, which shows that the man has a low sperm count. the couple asks why this is a problem because it only takes one sperm to fertilize an e...
Konu
SAT, 29.12.2021 04:10
Which of these factors would be considered when making a location decision at the region or community level?....
Konu
Mathematics, 29.12.2021 04:10
Find the domain of f(x). f(x) = √9x+36...
More questions: Spanish Another questions
See results (0)