AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

glacial erosion, the picking up and movement of earth beneath a glacier, is also referred to as plucking. erosion and transportation of individual pieces of bedrock, especially large "joint block occur as a result of this glacial erosion. plucking is type of erosion in which rocks become frozen into the bottom and sides of the glacier.as the glacier moves downhill it 'plucks' the rocks frozen into the glacier from the ground.