subject

Spanish, 07.07.2019 10:30 josetheghost6313

Question 5 unsaved question 5 options: choose the verb from the word bank that best completes the sentence and conjugate it. you only need to write the correct conjugation (not the whole sentence). word bank: tocar escuchar hablar estudiar enseñar nosotros en español en la clase.

ansver

Answers: 1

Show answers

Other questions on the subject: Spanish

Spanish, 21.06.2019 19:00, nickwwe13

How many neutrons does element x have if it’s stormy umber is 33 and it’s mass number is 95?

Answers: 1

Spanish, 23.06.2019 07:30, Ewesley15

Select the correct answer. which tener idiom correctly completes this sentence? pamela trabajar en la biblioteca el próximo semestre. a. tiene razón b. tiene vergüenza c. tiene pensado d. tiene cuidado

Answers: 2

Spanish, 23.06.2019 23:30, amandasantiago2001

Select the correct answer which sentence correctly conveys the same meaning as this sentence? eres miedoso. a. tienes miedo. b. tiene miedo. c. tengo miedo. d. tienen miedo.

Answers: 1

Spanish, 24.06.2019 12:00, eviemal120

Que techs es el viernes is hoy es martes, el 29 de diciembre

Answers: 2

You know the right answer?

Question 5 unsaved question 5 options: choose the verb from the word bank that best completes the s...

Questions in other subjects:

Konu

Mathematics, 04.04.2020 13:59

PLEASE HELP I WILL MARK BRAINLIEST...

Konu

Mathematics, 04.04.2020 13:59

PLEASE!! Dinah invests $850 in a high-yield savings account. The account pays 3% simple interest annually. Is it reasonable that Dinah will earn about $100 in simple in...

Konu

Biology, 04.04.2020 13:59

Which steps are part of the process during the formation of molded fossils? Check all that apply. Sediment hardens into rock. Sediment is eroded from rock....

Konu

Mathematics, 04.04.2020 13:59

PLEASE HELP WILL NAME BRAINLIEST...

Konu

Computers and Technology, 04.04.2020 14:00

Which of the following is true of data collection:. a. Data collection is of secondary importance to computer security. b. Data collection should not be attempted until there’s a p...

Konu

Physics, 04.04.2020 14:00

An air-plane has an effective wing surface area of 17.0 m² that is generating the lift force. In level flight the air speed over the top of the wings is 66.0 m/s, while the air spe...

Konu

Biology, 04.04.2020 14:00

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right....

Konu

Chemistry, 04.04.2020 14:00

2.00 moles of an ideal gas was found to occupy a volume of 17.4L at a pressure of 3.00 atm and at a temperature of 45 C. Calulate the value of the cas constant R in...

Konu

Mathematics, 04.04.2020 14:00

A group of n people enter an elevator in a building with k floors. Each person independently selects a floor uniformly at random (each with equal probability 1/k). The elevator sto...

Konu

Chemistry, 04.04.2020 14:01

What is likely to be true about the ∆H for this reaction? C6H6 (l) → C6H6 (s) ∆H>0 ∆H=0 ∆H<0...

More questions: Spanish Another questions