The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.

Charles darwin published his theory of evolution in 1859. in what way foes modern evolutionary theory differ from the theory as proposed by darwin? a) darwin inferred that individuals can evolve, but modern generic science has shown that this is not true. b)darwin inferred that individuals do not evolve, but modern genetic science has shown that this is not true. c)modern science has disproved most of darwin's original theory of evolution, because darwin knew nothing about generations and their role in heredity. d)generic studies have shown that gene expression and other factors operate along with natural selection, but most of darwin's theory has been supported by modern science.

Aeukaryotic cell must be from a plant if the cell a) a nucleus b) a nuclear envelope c) cytoplasm d) a cell wall

According to the big bang theory, after the "bang," the universe remained dark until about  300,000 yearsone billion yearsthree minutesthree billion years  later, when neutral atoms began to form.