Mathematics, 19.09.2021 14:00 noahmace

I will give brainliest if answer is right. A police detective has an 80% chance of solving any crime. The detective is given 5 crimes to solve. The probability that the detective solves exactly 3 of the 5 crimes can be expressed as a ratio of two relatively prime positive integers, a/b. Find a + b.

Answers: 1

Show answers

Other questions on the subject: Mathematics

Mathematics, 21.06.2019 14:30, stacy021603

In trapezoid efgh, m∠hef=(4x2+16)∘ and m∠gfe=(5x2+12)∘. find the value of x so that efgh is isosceles.

Answers: 1

continue

Mathematics, 21.06.2019 18:50, BrainzOli7408

If sr is 4.5cm and tr is 3cm, what is the measure in degrees of angle s?

Answers: 2

continue

Mathematics, 21.06.2019 21:30, achsahjosey

Acyclist bike x distance at 10 miles per hour .and returns over the same path at 8 miles per hour. what is the cyclist average rate for the round trip in miles per hour ?

Answers: 1

continue

Mathematics, 22.06.2019 00:30, ericka79

What is the mean of the data set 125, 141, 213, 155, 281

Answers: 2

continue

You know the right answer?

I will give brainliest if answer is right. A police detective has an 80% chance of solving any crime...

Questions in other subjects:

Chemistry, 04.07.2019 12:30

Which one is correct for number 6 i can’t decide...

History, 04.07.2019 12:30

James monroe, patrick henry, and george mason were leaders of which group?...

Social Studies, 04.07.2019 12:30

Which of the following is a true statement about the state & federal amendment processes? a) the process at the state level has more opportunity for direct voter input. b) th...

Chemistry, 04.07.2019 12:30

Is a flame test of an element a chemical or physical change?...

Mathematics, 04.07.2019 12:30

Vicki paid $22.95 for a sweater that usually sells for $27. what percent discount did she receive?...

Biology, 04.07.2019 12:30

In which of these illnesses do cells in one part of the body grow abnormally or out of control and possibly spread to other parts of the body?...

Spanish, 04.07.2019 12:30

Where is abraham ahora? with mrs. morningstar hiding with william en el cementerio en el zoológico...

History, 04.07.2019 12:30

Did the civil war end before or after the assassination of abraham lincoln...

Biology, 04.07.2019 12:30

5’atgcccgggtgtcgtagttga3’ complete the complementary sequence for theme template strand above. what would the mrna be based upon the template strand above? mrna what would the pri...

Biology, 04.07.2019 12:30

Explain the main difference between organisms of the domains bacteria and archaea and organisms of the domain eukarya....

More questions: Mathematics Another questions