5’atgcccgggtgtcgtagttga3’ complete the complementary sequence for theme template strand above. what would the mrna be based upon the template strand above? mrna what would the primary linear structure of the protein be based upon the mrna strand above?due tonight.

(drag each tile to the correct location.) categorize each term as something that is typical of a scientific theory, a scientific hypothesis, or both. - a tentative statement used to guide scientific investigations. - makes predictions about future events. - can be tested by many independent researchers. - based on observations of natural phenomena. - a well-established, highly reliable explanation.

What do nitrifying bacteria convert

In which layer do organisms on earth love?