Mathematics, 08.06.2021 20:00 mosesbalan7159

Which fractions are equivalent to 1/8? Choose all that apply

Answers: 1

Show answers

Other questions on the subject: Mathematics

Mathematics, 21.06.2019 13:00, ngj312

How many different ways can you make change for $.50 using only nickels, dimes, and quarters?

Answers: 2

continue

Mathematics, 21.06.2019 17:30, doodles51

How is the number of vertices for a prism related to the name of the prism

Answers: 1

continue

Mathematics, 22.06.2019 00:30, andy963936

The measures of two supplementary angles are (2x + 10)° and (8x + 10)°. what is the measure of the larger angle? a. 16° b. 44° c. 14° d. 138°

Answers: 2

continue

Mathematics, 22.06.2019 01:30, Mullins4

Novak gives 9 packs of paper to a group of 5 students. if the group shares the paper equally how many packs of paper does each student get. write the a answer as a mixed number

Answers: 1

continue

You know the right answer?

Which fractions are equivalent to 1/8? Choose all that apply...

Questions in other subjects:

Chemistry, 10.12.2020 07:30

Convert 4.50 e23 atoms of CO to grams....

Social Studies, 10.12.2020 07:30

Who will benefit most from the RTE act and why?...

Mathematics, 10.12.2020 07:30

Subscribe to me plz channel: Kallen Buzzard 100 POINTS ik when you have subscribed or not so don't lie pls...

History, 10.12.2020 07:30

Industrialism definition...

Biology, 10.12.2020 07:30

16. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand 5' - AACGGTCCAGTCCAAGTTACG - 3...

Mathematics, 10.12.2020 07:30

Rewrite in simplest terms: -10(-3m-10)-3(-8m+3)−10(−3m−10)−3(− 8m+3)...

Mathematics, 10.12.2020 07:30

Use the below images to answer questions 1-3. What is the area of the base of the shape? Round to the nearesthundredth.

Mathematics, 10.12.2020 07:30

Solve questions 21-26 and explain why. ...

Mathematics, 10.12.2020 07:30

The cost of 5 squash and 2 zucchini is $1.32. Three squash and 1 zucchini cost $0.75. Write a system of equation...

Mathematics, 10.12.2020 07:30

ten student agreed to conduct a survey of 3000 participants in 5 days. If five more boy join in before the work begins how many days should the survey take?...

More questions: Mathematics Another questions