16. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand
5' - AACGGTCCAGTCCAAGTTACG - 3

In german cockroaches, curved wing (cv) is recessive to normal wing (cv+). bill, who is raising cockroaches in his dorm room, finds that the frequency of the gene for curved wings in his cockroach population is 0.6. in his friend joe’s apartment, the frequency of the gene for curved wings is 0.2. one day joe visits bill in his dorm room, and several cockroaches jump out of joe’s hair and join the population in bill’s room. bill estimates that, now, 10% of the cockroaches in his dorm room are individual roaches that jumped out of joe’s hair. what is the new frequency of curved wings among cockroaches in bill’s room? 0.69 0.4 0.5 0.31 0.20

The images show the wings of a bat and a bee. from this evidence, what can you conclude about the evolutionary relationship between these organisms? a. the wing structures of the bat and the bee are different, indicating they didn’t inherit wings from a common ancestor. b. the wing structures of the bat and the bee are different, indicating they inherited wings from a common ancestor. c. the functions of bat wings and bee wings are the same, indicating they obtained wings from a common ancestor. d. the functions of bat wings and bee wings are different, indicating they didn’t obtain wings from a common ancestor.

~fourth largest plate ~includes parts of the indian and atlantic oceans ~subducts below the eurasian plate on the west side ~ the arabian and somali plates form boundaries with it what is the name of the tectonic plate described above? a) african plate b) eurasian plate c) north american plate d) indo- australian plate