subject
Mathematics, 27.02.2021 14:00 HaseelM

1 The geometric mean of two positive integers a and b is 27 Find all possible
values of a and b

ansver
Answers: 3
Show answers

Other questions on the subject: Mathematics

image
Mathematics, 21.06.2019 13:30, Geo777
Given a(-12,5) and b(12,29) find the point that divides the line segment ab three-eighths of the way from a to b
Answers: 1
continue
image
Mathematics, 21.06.2019 17:30, xdpugx0
Write an expression that has three terms and simplifies to 4x - 7. identify the coefficient(s) and constant(s) in your expression
Answers: 1
continue
image
Mathematics, 21.06.2019 20:10, lele142018
Which value of m will create a system of parallel lines with no solution? y = mx - 6 8x - 4y = 12
Answers: 3
continue
image
Mathematics, 22.06.2019 02:00, haybales6019
During how many months was the difference between the number of days with homework and with no homework greater than 6?
Answers: 1
continue
You know the right answer?
1 The geometric mean of two positive integers a and b is 27 Find all possible
values of a and...

Questions in other subjects:

Konu
Mathematics, 11.03.2021 01:00
A DVD has a diameter of 12 centimeters. What is the area of the DVD? Round your answer to the nearest hundreth. Use 3.14 for Pi. (Remember A = 3.14 · r^²) Blank cm...
Konu
Biology, 11.03.2021 01:00
Please help me The DNA base sequence for a short gene is TATGATACCTTGATAGCTATGTGATTG What is the amino acid sequence of the polypeptide produced according to this DNA...
Konu
Mathematics, 11.03.2021 01:00
Help me plz ill give extra points ...
Konu
Mathematics, 11.03.2021 01:00
The line L passes through the point p (2,4) and Q (6,10) calculate:the gradient of line L​...
Konu
Physics, 11.03.2021 01:00
Order the imagines of earth plates in order from oldest of earliest...
Konu
Mathematics, 11.03.2021 01:00
PLEASE HELP Is A'B'C'D' a translation, rotation, or reflection of ABCD? Explain how you can tell.
Konu
Mathematics, 11.03.2021 01:00
Randi and Craig ride their bikes at constant speeds. It takes Randi 6 hours to travel 18 miles. Craig can bike 10 miles in 5 hours , If Randi gives Craig a 2 mile head...
Konu
Mathematics, 11.03.2021 01:00
Si boss de toy story sabe que no es un muñeco, porque se queda quieto cuando llega andy...
Konu
Mathematics, 11.03.2021 01:00
A recent survey found that 71% of all adults over 50 wear sunglasses for driving. In a random sample of 60 adults over 50, what is the mean and standard deviation of those that wea...
Konu
Mathematics, 11.03.2021 01:00
Split the number 76 into the ratio 6:3:7:3 ....
More questions: Mathematics Another questions
See results (0)