Please help me The DNA base sequence for a short gene is
TATGATACCTTGATAGCTATGTGATTG
What is the amino acid sequence of the polypeptide produced according to this DNA information? Use the genetic code chart below and your knowledge of
transcription and translation to figure out the message?

Ineed to get this test done which of the following statements is correct in hour our immune system responds to a potential pathogen? a.) the skin will be the first line of defense, and then the many phagocytes in the bloodstream will attempt to consume the possible pathogen. b.) b cells will start reading the antigen code immediately and call t cells to assist in destroying the pathogen. c.) the adapted immune system will call on the innate immune system to destroy the pathogen. d.) the t-cells in the adapted immune systems are the first to recognize the pathogen