Mathematics, 13.11.2020 01:00 GabbyLandry

Please I need help Asap I give 30 points if I get it rights the question is in the picture

Answers: 3

Show answers

Other questions on the subject: Mathematics

Mathematics, 21.06.2019 15:20, loves2ballet

With this one. will mark brainliest

Answers: 1

continue

Mathematics, 21.06.2019 18:00, nathanowens121224

If 1/√5+1/√5+1=p+q√r , find the values of p, q and r

Answers: 2

continue

Mathematics, 21.06.2019 20:00, Kalle91106

Can someone factor this fully? my friend and i have two different answers and i would like to know if either of them is right. you in advance. a^2 - b^2 + 25 + 10a

Answers: 1

continue

Mathematics, 22.06.2019 00:30, ajam71501

Pls as soon as ! will award brainliest and 20 ! also the answer is not 22.5 degrees! find the value of x in each case:

Answers: 3

continue

You know the right answer?

Please I need help Asap I give 30 points if I get it rights the question is in the picture
...

Questions in other subjects:

Business, 16.04.2020 23:14

Eastern Corporation has $1,000 par value bonds with 4 years to maturity. The bonds pay an 8% coupon rate with semi-annual coupon interest payments. The bond's closing price is quot...

Mathematics, 16.04.2020 23:14

Gravel is being dumped from a conveyor belt at a rate of 20 cubic feet per minute. It forms a pile in the shape of a right circular cone whose base diameter and height are always e...

Spanish, 16.04.2020 23:14

10 citas textuales donde puedan ubicar figuras heroicas...

Mathematics, 16.04.2020 23:14

F(x) = (x – 4)(x + 2)? which point is an x intercept of the quadratic function...

Mathematics, 16.04.2020 23:14

The measure of a central angle is 80 degrees. The length of the radius is 40 mm. Determine the arc length....

Biology, 16.04.2020 23:14

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to determine if this seq...

Chemistry, 16.04.2020 23:14

Consider N O2 molecules in a container of volume V at a pressure of P=1 atm and a temperature of T=298K. a. Calculate the collision frequency Z1 of a single O2 molecule under these...

Mathematics, 16.04.2020 23:14

A researcher records the repair cost for 2020 randomly selected stereos. A sample mean of $57.17$ 57.17 and standard deviation of $19.26$ 19.26 are subsequently computed. Determine...

Mathematics, 16.04.2020 23:14

Look at the pentagonal numbers. Use finite differences to determine which function represents the pattern. f(x) = 1.5x + 0.5x f(x) = 1.5x2 + 1.5x f(x) = 1.5...

Mathematics, 16.04.2020 23:14

Katie and Tyler are working at their lemonade stand. An hour ago, their pitcher of lemonade was 78 full. Since then, they have sold 12 of a pitcher of lemonade. What fraction of a...

More questions: Mathematics Another questions