Biology, 16.04.2020 23:14 cpcoolestkid4

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to determine if this sequence might be within the coding region of a gene, you examine it for open reading frames. How many open reading frames exist that go all the way through this DNA fragment? (Recall that the stop codons are 5' TAA, 5' TAG, and 5' TGA.)

Answers: 3

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 22:30, kaylin28

What happens whenever a net force acts on an object

Answers: 1

continue

Biology, 22.06.2019 06:00, irvinbhangal2

In "the man in the water," what was the remarkable occurrence that rosenblatt reported?

Answers: 1

continue

Biology, 22.06.2019 13:10, lily1482

Which of the following is likely not involved in this example of ecological succession? a) the rotting remains of plants add to the fertility of the soil. b)the soil becomes so fertile that eel grass is replaced by other plant species. c) the roots from plants stabilize the sediment, keeping it in place. d) the concentration of salt becomes so high that all plant life is destroyed.

Answers: 1

continue

Biology, 22.06.2019 20:30, deena7

The backbone of the double helix has an alternating molecules. what do you call these alternating molecule?

Answers: 2

continue

You know the right answer?

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small...