Mathematics, 29.05.2020 17:57 ariana7245

Which expression represents the average of three test scores? x + y + z 3 (x + y + z) StartFraction x + y + z over 3 EndFraction StartFraction x y z over 3 EndFraction

Answers: 1

Show answers

Other questions on the subject: Mathematics

Mathematics, 21.06.2019 19:00, mayalp

What is the expression in factored form? 225x^2 - 144 a. 9(5x+4)^2 b. 9(5x-4)^2 c. 9(4x+5)(4x-5) d. 9(5x+4)(5x-4)

Answers: 2

continue

Mathematics, 22.06.2019 01:00, jarteria0

Which angle has the same measure as the dehedral angle formed by the orange face and the purple rectangle

Answers: 1

continue

Mathematics, 22.06.2019 01:00, chandranewlon

Ellie spent $88.79 at the computer stote. she had $44.50 left to buy a cool hat. how much money did she originally have? write and solve an equation to answer the question.

Answers: 2

continue

Mathematics, 22.06.2019 02:30, EBeast7390

In one month jillian made 36 local phone calls and 20 long-distance calls what was her ratio of local calls to long-distance calls for that month?

Answers: 1

continue

You know the right answer?

Which expression represents the average of three test scores? x + y + z 3 (x + y + z) StartFraction...

Questions in other subjects:

Biology, 21.01.2021 22:30

Which statement best describes the interdependence of photosynthesis and cellular respiration? A. The reactants of photosynthesis are sugar and oxygen to be used in cellular respi...

Computers and Technology, 21.01.2021 22:30

Write a simple program where you create an array of single byte characters. Make the array 100 bytes long. In C this would be an array of char. Use pointers and casting to put INTE...

Mathematics, 21.01.2021 22:30

A person in a boat floating in a small pond throws an anchor overboard. What happens to the level of the pond...

Mathematics, 21.01.2021 22:30

jogs every three days andjogs every four days. if today is a wednesday and and both jog today, in how many days will they both jog again on the same day of the week which day of th...

Computers and Technology, 21.01.2021 22:30

Match the appropriate words to complete the paragraph. Wireless networks have no clear boundaries, therefore securing communications requires strong (a), (b), and (c) protocols. On...

Chemistry, 21.01.2021 22:30

a solution of dextrose contains 25.0 g solute in 250.0 g water. how should the percentage by mass of dextrose in this solution be calculated...

Chemistry, 21.01.2021 22:30

Green plants absorb sunlight to power photosynthesis, the chemical synthesis of food from water and carbon dioxide. The compound responsible for light absorption and the color of p...

History, 21.01.2021 22:30

WHY IS DRAKE SO FRGGIN COOOLIO ??? LIKE I LOVE HIM HAHAHAH ANYWAYS I NEED HELP ANS FRIEDNDSS HAHAHAHA...

Biology, 21.01.2021 22:30

Given the following DNA strand TACGTATGCCGTATGGGCATT a) What is the DNA compliment to given strand?b) What is the mRNA compliment to the given strand?...

English, 21.01.2021 22:30

Part B: Which quotation from heart of darkness best supports that answer to part A...

More questions: Mathematics Another questions