subject
Biology, 21.01.2021 22:30 Andresssophie7379

Given the following DNA strand TACGTATGCCGTATGGGCATT a) What is the DNA compliment to given strand?

b) What is the mRNA compliment to the given strand?

ansver
Answers: 1
Show answers

Other questions on the subject: Biology

image
Biology, 22.06.2019 00:30, azktanae5855
Ais a landform that is formed at the mouth of a river from the deposition of sediment carried by the river as the water flows.
Answers: 2
continue
image
Biology, 22.06.2019 11:00, elpeke102p73fz3
Which short-term environmental changes would a very small asteroid or comet impact on earth most likely cause? check all that apply. flooding extinction craters on surface changes in weather patterns death of organisms and populations
Answers: 2
continue
image
Biology, 22.06.2019 13:50, srosrguezbracho
18. how do the cells in meiosis differ from the cells in mitosis?
Answers: 2
continue
image
Biology, 22.06.2019 18:40, memoryofdale
Hey everybody i need with a biology question. all the gametes of isogamous organisms are genetically identical. true false
Answers: 1
continue
You know the right answer?
Given the following DNA strand TACGTATGCCGTATGGGCATT a) What is the DNA compliment to given strand?...

Questions in other subjects:

Konu
English, 31.01.2020 13:48
Iwant to be about musicwrite a poem that: ~ uses a form appropriate to the topic and subject matter ~ includes use of at least 3 sound devices, including: ...
Konu
Mathematics, 31.01.2020 13:48
The standard form of 4.5367 * 105 is a. 453.67 b. 4536.7 c. 45,367 d. 453,670 e. 4,536,700...
Konu
Mathematics, 31.01.2020 13:48
Last year a large trucking company delivered 2.25 × 10^6tons of good with an average value of$15,000 per ton. what was the total value of good delivered? w...
Konu
Physics, 31.01.2020 13:48
Achild makes a ramp to push his toy dump truck up to his sandbox if he uses 5 newtons of force to push the 12 newton truck up the ramp what is the mechanical advantage of his ramp...
Konu
Mathematics, 31.01.2020 13:48
Solving systems of equations using substitution...
Konu
Mathematics, 31.01.2020 13:48
Which of the following options results in a graph that shows exponential growth? a. f(x) = 0.4(3)x b. f(x) = 3(0.5)x c. f(x) = 0.8(0.9)x d. f(x) = 0.9(5)−...
Konu
Mathematics, 31.01.2020 13:48
The picture shows a barn door. what is the length of the bar ac? 6 sin 60° 6 cos 60°
Konu
Business, 31.01.2020 13:48
Which item quantifies a business plan?...
Konu
Mathematics, 31.01.2020 13:48
The endpoints of (line segment )ab are a(2, 2) and b(3, 8). (line segment ) ab is dilated by a scale factor of 3.5 with the origin as the center of dilation to give image (line seg...
Konu
Mathematics, 31.01.2020 13:48
Adog sled driver added more gear to the sled doubling its weight this felt too heavy so the driver removed 20 pounds to reach the final weight of 180 pounds write and solve an equa...
More questions: Biology Another questions
See results (0)