subject

Mathematics, 03.01.2020 07:31 19King73

Anew car is purchased for 207000 dollars. the value of the car depreciates at 11% per year. what will the value of the car be, to the nearest cent, after 11 years?

ansver

Answers: 2

Show answers

Other questions on the subject: Mathematics

Mathematics, 21.06.2019 17:30, dommalb

Which of the following tables represents exponential functions?

Answers: 1

Mathematics, 21.06.2019 19:00, doodles51

Use the quadratic formula to solve the equation. if necessary, round to the nearest hundredth. x^2 - 20 = x a. 5, 4 b. -5, -4 c. -5, 4 d. 5, -4

Answers: 2

Mathematics, 21.06.2019 19:30, miracle96

Choose the more precise measurement. 26.4 cm or 8.39 cm

Answers: 1

Mathematics, 21.06.2019 22:00, Treezy11

Two numbers have a sum of -19. one number is x. what expression represents the other number?

Answers: 2

You know the right answer?

Anew car is purchased for 207000 dollars. the value of the car depreciates at 11% per year. what wil...

Questions in other subjects:

Konu

Business, 15.04.2020 03:53

Consider the equation %ΔM + %ΔV ≈ %ΔP + %ΔY. If the velocity of money does not change (%ΔV = 0), and the change in real GDP exactly keeps pace with the change in the money supply (...

Konu

English, 15.04.2020 03:53

The main idea is usually found after the topic sentence. True False...

Konu

Mathematics, 15.04.2020 03:53

What is the approximate area of the figure ?...

Konu

Social Studies, 15.04.2020 03:54

Jane enters into a contract with Jill to provide 100 roses for a dinner party. Jill fails to deliver the roses. Jane initiates a suit against Jill, asking the court to order Jill t...

Konu

Business, 15.04.2020 03:54

Suppose that when the price of wheat is $2 per bushel, farmers can sell 10 million bushels. When the price of wheat is $3 per bushel, farmers can sell 8 million bushels. Which of t...

Konu

Biology, 15.04.2020 03:54

Multicellular organisms evolved from three different ancestral lineages: stramenopiles, unikonts, and archaeplastids. Of these, fungi and animals evolved from two different lineage...

Konu

Physics, 15.04.2020 03:54

The plates of a parallel-plate capacitor are 2.50 mm apart, and each carries a charge of magnitude 77.0 nC. The plates are in vacuum. The electric field between the plates has a ma...

Konu

Business, 15.04.2020 03:54

Which of the following reasons for diversification is MOST likely to increase the firm's value? a. Increasing managerial compensation b. Taking advantage of changes i...

Konu

Biology, 15.04.2020 03:54

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to determine if this seq...

Konu

Mathematics, 15.04.2020 03:54

A newly constructed fish pond contains 1000 liters of water. Unfortunately, the pond has been contaminated with 5 kg of a toxic chemical during the construction process. The pond's...

More questions: Mathematics Another questions