subject
Biology, 15.04.2020 03:54 shacarabrown49

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to determine if this sequence might be within the coding region of a gene, you examine it for open reading frames. How many open reading frames exist that go all the way through this DNA fragment?

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 22:00, Dweath50
List charasteristics of athenosphere
Answers: 1
image
Biology, 22.06.2019 05:00, crtlq
What best describes the dropping height of a ball that bounces back up to a height of 45 cm
Answers: 1
image
Biology, 22.06.2019 14:00, florencemarti7331
As a result of these processes the single celled organism accomplishes
Answers: 1
image
Biology, 22.06.2019 16:30, robbinsjeffrey271
Which of the following cognitive skills have not been displayed by animals? a. using tools b. forming concepts c. transmitting culture d. using syntax
Answers: 1
You know the right answer?
You perform Sanger sequencing on a small fragment of the human genome and obtain the following small...

Questions in other subjects:

Konu
Mathematics, 02.01.2020 21:31
Konu
Mathematics, 02.01.2020 21:31