subject

Mathematics, 09.10.2019 00:30 SarahBelle5663

Pedro trabalha em uma oficina mecanica com o seu pai. ele recebe um salario fixo de r$1800,00 por mes, e dependendo dos conseitos ainda pode receber comissão

ele guarda em media 1/9 desse valor todos os meses em em sua poupança

depois de um ano quanto ele tera guardado?

ansver

Answers: 3

Show answers

Other questions on the subject: Mathematics

Mathematics, 21.06.2019 14:00, robertsabbiegale

Brook states that the distance on the line is 4 units. caleb states that the whole line does not have a distance because it continues on forever. vivian states that the line is 6 units long. which distance did brook measure? which distance did vivian measure?

Answers: 1

Mathematics, 22.06.2019 00:30, brittsterrr

When you flip a biased coin the probability of getting a tail is 0.6. how many times would you expect to get tails if you flip the coin 320 times?

Answers: 1

Mathematics, 22.06.2019 02:40, elora2007

Which method of gathering data will be most effective in learning how diet and fitness choices affect long-term healt

Answers: 1

Mathematics, 22.06.2019 03:00, bentleyking1k

More than 450450 students traveled to a state park for a field trip. the school allowed 66 students to travel by car, and the rest traveled on 1111 buses, each of which held the same number of students. if there were ss students in each bus, which inequality best represents this situation?

Answers: 1

You know the right answer?

Pedro trabalha em uma oficina mecanica com o seu pai. ele recebe um salario fixo de r$1800,00 por me...

Questions in other subjects:

Konu

Business, 15.04.2020 03:54

Which of the following reasons for diversification is MOST likely to increase the firm's value? a. Increasing managerial compensation b. Taking advantage of changes i...

Konu

Biology, 15.04.2020 03:54

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to determine if this seq...

Konu

Mathematics, 15.04.2020 03:54

A newly constructed fish pond contains 1000 liters of water. Unfortunately, the pond has been contaminated with 5 kg of a toxic chemical during the construction process. The pond's...

Konu

Mathematics, 15.04.2020 03:54

1. Write the polynomial in standard form. Identify the degree and leading coefficient of the polynomial. $-3p^3+5p^6-4$ The polynomial in standard form is:. Th...

Konu

Mathematics, 15.04.2020 03:54

Mitch wants to buy a camera. The sale price is $291. What was the original price? 25% off original price....

Konu

Computers and Technology, 15.04.2020 03:54

We have the following functional dependencies: course_no, student_id -> grade course_no -> course_name We have the following relation schema: STU_...

Konu

Physics, 15.04.2020 03:54

A man unloads a 4.0-kg box from a moving van by giving it an initial speed of 1.1 m/s down a ramp that makes an angle of 18° with the horizontal. It slides with negligible friction...

Konu

Business, 15.04.2020 03:54

One reason new products fail is that although most major corporations use a formal decision-making process, sometimes they fail to critically evaluate the progress along the way. T...

Konu

Health, 15.04.2020 03:54

Max is a seven-month-old baby who was abandoned at an orphanage. He does not get enough nutrition and has not put on any weight in the last few months. A medical worker examines Ma...

Konu

Business, 15.04.2020 03:54

A large retail organization previously divided work among its four employee-benefitsstaff into distinct specializations. One person answered all questions about superannuation (pen...

More questions: Mathematics Another questions