Mathematics, 23.06.2019 17:00 bandiadummy8595

Find the common difference if the arithmetic sequence 4,10,16,22

Answers: 2

Show answers

Other questions on the subject: Mathematics

Mathematics, 21.06.2019 20:50, googoo4

Including 6% sales tax, an inn charges $135.68 per night. find the inns nightly cost

Answers: 1

continue

Mathematics, 21.06.2019 23:00, annnoe5128abc

Asporting good store is offering 30 percent off of the original price(x) of football cleats. the discount will be reduced by an another $7 before sales tax.

Answers: 1

continue

Mathematics, 21.06.2019 23:00, Kira4585

Divide. –4.2 ÷ 6 = a –0.7 b 0.7 c –7 d 7 me

Answers: 2

continue

Mathematics, 22.06.2019 02:40, sahergi15

Ineed the answers for this one as well!

Answers: 1

continue

You know the right answer?

Find the common difference if the arithmetic sequence 4,10,16,22...

Questions in other subjects:

Social Studies, 06.12.2021 09:50

Hello y'all it's midnight already haystshout out to my girl friend...

Mathematics, 06.12.2021 09:50

Given line AB is parallel to line DE and C is the midpoint of AE. Prove line BC is congruent to line DC...

History, 06.12.2021 09:50

Why do you think the Cities and Mohejo-Dara developed along the Indus River...

Mathematics, 06.12.2021 09:50

How are the SAS Postulate and SSS Postulate alike? Check all that apply. A. They both require three congruency statements. B. They both use two sides and one angle. C...

Mathematics, 06.12.2021 09:50

460,451,442,... Find the 37th term. Find the 37th term....

Biology, 06.12.2021 09:50

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutati...

Biology, 06.12.2021 09:50

What is the building unit that enters the plant cell organelle membranes? A -fatty acids b -ribose sugar c -simple lipids d -nucleic acids...

Mathematics, 06.12.2021 09:50

Suppose that the number of cars manufactured at an automobile plant varies jointly as the number of workers and the time they work. If 220 workers can produce 198 cars in 5 hours,...

Biology, 06.12.2021 09:50

If you were given a cylindrical structure cut from part of a plant, how could you tell whether it was a piece of stem or a piece of root:...

English, 06.12.2021 09:50

Pre-Reading White Man's Burden 1b. Why was White Man's Burden written? 1c. Why might the White Man's Burden be an important historical document? (How might this docum...

More questions: Mathematics Another questions