subject

Biology, 06.12.2021 09:50 ayoismeisjjjjuan

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' 5'

Type of mutation (3pts):

Amino acid ( 3pts):

Type of mutation ( 3pts):

4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mutated DNA sequence: 3' 5'

Type of mutation ( 3pts) :

Amino acid ( 3pts):

Type of mutation ( 3pts):

ansver

Answers: 2

Show answers

Other questions on the subject: Biology

Biology, 22.06.2019 07:00, doris8051

What was the purpose of mendel's experiments with dihybrid crosses? a. to determine if dna was a transforming factor b. to determine if traits could be recessive c. to determine if traits affected each other d. to determine if traits had more than one allele

Answers: 3

Biology, 22.06.2019 09:50, Riplilpeep

What are characteristics of minerals? select 3 choices

Answers: 1

Biology, 22.06.2019 10:00, abbypark0804

Which step is not included in the step approach to calculating the greatest common divisor?

Answers: 3

Biology, 22.06.2019 13:00, shanicet047ox9ff6

This rapid change in species that rarely leaves behind fossil evidence is referred to as

Answers: 3

You know the right answer?

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' 5'

Type...

Questions in other subjects:

Konu

Business, 29.06.2019 07:50

Avictim of phishing would most likely be contacted in which of these ways? o a. by computer o b. by telephone o c. by fax o d. in person...

Konu

English, 29.06.2019 07:50

What does the dogs behavior reveal about it...

Konu

English, 29.06.2019 07:50

Using an analogy is an effective way tooa) create a dissociative web of connotations. ob) spice up an otherwise flat and uninteresting writing style. oc) get across the meaning of...

Konu

Physics, 29.06.2019 07:50

Which option accurately describes a scenario in which a tortoise experiences a displacement of 10 m south? a tortoise starts at a position of 3 m south. it moves 4 m east, 2 m wes...

Konu

History, 29.06.2019 07:50

Select the correct answer. how does outlining contribute to the process of speechwriting? a. it gives speakers a clearer vision of the topic of discussion. b. it speakers organ...

Konu

Physics, 29.06.2019 07:50

Acan as soft drink at room temperature is put into refrigerator so that it will cool. would you model the can of soft drink a closed system or an open system .explain...

Konu

History, 29.06.2019 07:50

Use the map below that shows the populations of european countries to answer the following question: central european countries are generally more populated than western european...

Konu

Business, 29.06.2019 07:50

Asap! a progressive tax means you pay a larger percent of your income in taxes as you make more money. true or false?...

Konu

Spanish, 29.06.2019 07:50

Read and choose the option with the correct verb to complete the sentence. el edificio rojo y muy bajo. es está son están...

Konu

Mathematics, 29.06.2019 07:50

Abeach ball rolls off a cliff and onto the beach. the height, in feet, of the beach ball can be modeled by the function h(t)=64–16t^2, where t represents time, in seconds. what is...

More questions: Biology Another questions