Biology, 06.11.2020 23:30 blackjack73
What is the purpose of a domain?
Answers: 3
Biology, 22.06.2019 11:30, alvaradolm9723
Female luna moths (actias luna) attract males by emitting chemical signals that spread through the air. a male hundreds of meters away can detect these molecules and fly toward their source. the sensory organs responsible for this behavior are the comblike antennae visible in the photograph shown here. each filament of an antenna is equipped with thousands of receptor cells that detect the sex attractant. based on what you learned in this chapter, propose a hypothesis to account for the ability of the male moth to detect a specific molecule in the presence of many other molecules in the air. what predictions does your hypothesis make? design an experiment to test one of these predictions.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00, mimivenga
Astudy by solloch and et. al., in 2017, gives the map above which shows the frequency of alleles with a ccr5-delta32 mutations over 87 different countries. this mutation deletes the presence of a co-receptor (ccr5) on the outside of human t-cells (lymphocytes). some viruses, such as the one responsible for the black death and human immunodeficiency virus (hiv), require this receptor for attachment to host cells during the infection process. the black death was an epidemic that passed over northern europe during the 14th century killing nearly 60% of europeans. according to this information, which explanation best explains why northern europeans show a greater immunity for hiv than some other parts of the world?
Answers: 1
What is the purpose of a domain?...
Social Studies, 04.03.2021 20:20
Chemistry, 04.03.2021 20:20