You have identified a novel gene, Ums1, whose protein product is a component of the RISC in the nematode C. elegans. You believe this protein (like all the RISC proteins) is critical for the production of miRNAs, in particular ones that slice the mRNA for a gene called Trtn1. Describe how you would use RNAi in worm lysates to knockdown Ums1 and show that slicing of Trtn1 is inhibited without Ums1. Include details like what part of Ums1 you would target with siRNAs, how trigger RNA would be delivered to the worms, and how you assay for sliced or unsliced Trtn1 mRNA. Show what positive results would look like (probably with an illustration of an autorad or bar graphs).

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?