Social Studies, 02.12.2021 04:20 meep26wesley

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place. ATTTGCATACTACCGGGC The red letters are the noncoding region, and the black letters are the protein coding region. ATTAGCATACTACGGGC ATTTGCATACTGACCGGGC ATTTGCAATACTACCGGGC ATTTGCAACTACCGGGC ATGAATGCATACTACCGGGC

Answers: 3

Show answers

Other questions on the subject: Social Studies

Social Studies, 22.06.2019 17:40, bellarides

Put the following steps for calculating net worth in the correct order. step #1: step #2: step #3: step #4: step #5:

Answers: 2

continue

Social Studies, 23.06.2019 05:30, weeblordd

Aregion home to ancient civilization

Answers: 1

continue

Social Studies, 23.06.2019 11:00, barry14201

What was the purpose of the cuban revolution

Answers: 1

continue

Social Studies, 23.06.2019 14:40, jones03riley

People who, by midlife, have begun to integrate the "masculine" and "feminine" sides of their personalities tend to be higher in neuroticism. lower in autonomy. psychologically healthier. lower in psychosocial maturity.

Answers: 2

continue

You know the right answer?

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the se...

Questions in other subjects:

Biology, 12.12.2019 21:31

Amutation in the operator region of the trp operon can prevent the trp repressor from binding to this operator. when these mutant cells are placed in a solution containing chicken...

Biology, 12.12.2019 21:31

Anitroglycerine patch is placed on the skin of a person with a history of chest pain induced by exertion. the drug is absorbed across the skin into the blood of the circulatory sys...

Business, 12.12.2019 21:31

If c(x) is the cost of producing x units of a commodity, then the average cost per unit is c(x) = c(x)/x. consider the cost function c(x) given below. c(x) = 16,000 + 140x + 4x3/2...

Physics, 12.12.2019 21:31

Which best describes the relationship between the governance pathway and the regulation pathway? the governance pathway involves military jobs that the regulation path...

Social Studies, 12.12.2019 21:31

If mr. smith's bike has been sent to his new address, but the bill to his old one, it can most likely be attributed to a lack of data group of answer choices a. dupli...

Mathematics, 12.12.2019 21:31

Idon’t understand this question. any will be appreciated : ).

Business, 12.12.2019 21:31

If a mutual fund portfolio earned a return that exceeded the return on the s& p 500 stock index, you may conclude that the fund outperformed the market on a risk-adjusted basis...

Mathematics, 12.12.2019 21:31

If f(–2) = 0, what are all the factors of the function f(x) = x^3 - 2^2 - 68x - 120? use the remainder theorem....

Business, 12.12.2019 21:31

If electricity costs 7.06 cents/kwh, how much would it cost you to run a stereo system per day for...

Mathematics, 12.12.2019 21:31

Use the number line below to determine the ratio of ad to ei. a. 3: 8 c. 3: 4 b. 4: 3 !

More questions: Social Studies Another questions