This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place. ATTTGCATACTACCGGGC

The red letters are the noncoding region, and the black letters are the protein coding region.

ATTAGCATACTACGGGC
ATTTGCATACTGACCGGGC
ATTTGCAATACTACCGGGC
ATTTGCAACTACCGGGC
ATGAATGCATACTACCGGGC

In a thunderstorm, charge builds up on the water droplets or ice crystals in a cloud. thus, the charge can be considered to be distributed uniformly throughout the cloud. for the purposes of this problem, take the cloud to be a sphere of diameter 1.00 kilometer. the point of this problem is to estimate the maximum amount of charge that this cloud can contain, assuming that the charge builds up until the electric field at the surface of the cloud reaches the value at which the surrounding air breaks down. this breakdown means that the air becomes highly ionized, enabling it to conduct the charge from the cloud to the ground or another nearby cloud. the ionized air will then emit light due to the recombination of the electrons and atoms to form excited molecules that radiate light. in addition, the large current will heat up the air, resulting in its rapid expansion. these two phenomena account for the appearance of lightning and the sound of thunder. take the breakdown electric field of air to be eb=3.00ă—106n/c. part a estimate the total charge q on the cloud when the breakdown of the surrounding air is reached. express your answer numerically, to three significant figures, using ďµ0=8.85ă—10â’12c2/(nâ‹…m2) .

What determines the amount of inertia an object has

The two stars in a certain binary star system move in circular orbits. the first star, alpha, has an orbital speed of 36 km/s. the second star, beta, has an orbital speed of 12 km/s. the orbital period is 137 d. a) what is the mass of the star alpha? b) what is the mass of the star beta?