Mathematics, 11.03.2020 00:58 Queenashley3232

Can someone help me with this

Answers: 3

Show answers

Other questions on the subject: Mathematics

Mathematics, 20.06.2019 18:04, nommies005

Prove the divisibility of the following numbers: ! i have no any is 1. 16^5 + 2^15 by 33 2. 15^7 + 5^13 by 30

Answers: 1

continue

Mathematics, 21.06.2019 18:00, kk042563

Negative 5 1/12 + negative 4 1/4 + 6 3/4

Answers: 1

continue

Mathematics, 21.06.2019 20:30, mrguyman

Cody was 165cm tall on the first day of school this year, which was 10% taller than he was on the first day of school last year.

Answers: 1

continue

Mathematics, 21.06.2019 21:30, munch1239

If 1.4% of the mass of a human body is calcium, how many kilograms of calcium are there in a 165-pound man? 1.0 kg ca 5.1 kg ca 1.0 x 102 kg ca 5.1 x 102 kg ca

Answers: 1

continue

You know the right answer?

Can someone help me with this

...

Questions in other subjects:

History, 29.12.2021 04:10

In what ways did WWII-era policies deliver prosperity to white veterans and their families while preventing the same for Americans and veterans of color...

English, 29.12.2021 04:10

I hesitated long before I put this theory to the test of practice. I knew well that I risked death; for any drug that so potently controlled and shook the very fortress of identity...

SAT, 29.12.2021 04:10

The population density of orangeland is 18 orange trees per acre. Exactly 792 orange trees grow in orangeland. How many acres are in orangeland?....

SAT, 29.12.2021 04:10

Kent multiplies both sides of the equation below by an expression. K + startfraction 12 over k endfraction = 8 then he moves all the terms to one side of the equal sign in the resu...

SAT, 29.12.2021 04:10

Compare the character of faustus at the beginning of the play with his character at the end. How have his character traits and basic ambitions shifted over the course of the play?...

Biology, 29.12.2021 04:10

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA...

SAT, 29.12.2021 04:10

A stone fell from the top of a cliff into the ocean. In the air, it had an average speed of 161616 \text{m/s}m/sstart text, m, slash, s, end text. In the water, it had an average s...

Mathematics, 29.12.2021 04:10

What is 18 1/5 -7 3/5 as a mixed number in simplest form...

SAT, 29.12.2021 04:10

What are the typical sources of data which is used for data analytics....

Chemistry, 29.12.2021 04:10

Which of these describes a human activity that uses up a non-renewable resource? building new roads that cause topsoil to erode chopping down trees from the forest fo...

More questions: Mathematics Another questions