Write a python program that converts an input file in fasta format, called
"fasta. txt", to an...
![subject](/tpl/images/cats/informatica.png)
Computers and Technology, 17.12.2019 05:31 duhitsmiracle59
Write a python program that converts an input file in fasta format, called
"fasta. txt", to an output file in phylip format called "phylip. txt".
for example if the input file contains:
> human
accgttatac
cgatctcgca
> chimp
acggttatac
cgtacgatcg
> monkey
acctctatac
cgatcgatcc
> gorilla
atctatatac
cgatcgatcg
then the output file should be
human accgttataccgatctcgca
chimp acggttataccgtacgatcg
monkey acctctataccgatcgatcc
gorilla atctatataccgatcgatcg
fasta format has a description (indicated with a '> ') followed by 1 or
more lines of a dna sequence. phylip format has a description followed
by a single line of a dna sequence and each sequence is the same length.
for this homework, the input file will have an arbitrary number of
sequences of arbitrary, but identical, length
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Computers and Technology
![image](/tpl/images/cats/informatica.png)
Computers and Technology, 22.06.2019 15:10, passions3534ovf6dt
Which activity should be part of a long-term plan to positively affect yourhealth? oa. wearing regular clothing when handling toxinsob. not worrying about secondhand smokeoc. avoiding excessive exposure to sunlightod. drinking only well water
Answers: 1
![image](/tpl/images/cats/informatica.png)
Computers and Technology, 22.06.2019 20:00, jayjay5246
What is the term for water wave that is created by an underwater earthquake
Answers: 1
![image](/tpl/images/cats/informatica.png)
Computers and Technology, 23.06.2019 02:00, kelseybell5522
For a typical middle-income family, what is the estimated cost of raising a child to the age of 18? $145,500 $245,340 $304,340 $455,500
Answers: 1
You know the right answer?
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 05.03.2021 16:30
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 05.03.2021 16:30
![Konu](/tpl/images/cats/health.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 05.03.2021 16:30
![Konu](/tpl/images/cats/mat.png)
Mathematics, 05.03.2021 16:30
![Konu](/tpl/images/cats/biologiya.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 05.03.2021 16:30