Dna encodes the information necessary to produce the proteins needed by your body. to makes these proteins, dna first undergoes a process known as transcription. this is when information on a dna is transferred to a mol; ecule very similar to dna, known as

Which best compares habitat and niche? o niche is a place in which organisms live, and habitat is the way in which an organism fits into its habitat. o habitat is a place in which organisms live, and niche is the way in which an organism fits into its habitat. habitat is a group of organisms that live in an area, and niche is a specific species that lives in that areao niche is a group of organisms that live in an area, and habitat is a specific species that lives in that area.

Which is a function performed by stem cells in the skin a. replacing lost skin cells b. making cells for the intestines c. growing new organs d. differentiating into brain cells plz apex

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?