subject
Biology, 23.07.2019 11:00 tami5

What is the main structures in plant cells that are not animal cells?

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 14:50, toricarter00
Where do homologous chromosomes exchange genetic material through crossing over?               a.  chlorophyll    b.  centrosomes    c.  centromeres    d.  chiasma
Answers: 2
image
Biology, 22.06.2019 08:50, gigimasters71p7tc6l
How do you know that the plant cells in these two images have different jobs, or functions? a. because all plant cells serve different functions b. because they are two different colors c. because their dna are different d. because their structures are different
Answers: 1
image
Biology, 22.06.2019 11:00, isaiahromero15
Identify two examples of chemical reactions that you have encountered during the last week. identify an exothermic and endothermic reaction. explain.
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What is the main structures in plant cells that are not animal cells?...

Questions in other subjects:

Konu
Social Studies, 22.01.2020 21:31
Konu
Mathematics, 22.01.2020 21:31