Biology, 25.08.2019 12:30 marvinsductant6710
Explain how an mrna molecule directs the synthesis of a protein
Answers: 1
Biology, 22.06.2019 06:00, reginapokorny
Duchenne muscular dystrophy is a serious condition caused by a recessive allele of a gene on the human x chromosome. the patients have muscles that weaken over time because they have absent or decreased dystrophin, a muscle protein. they rarely live past their twenties. how likely is it for a woman to have this condition? a) women can never have this condition. b) one-fourth of the daughters of an affected man would have this condition. c) one-half of the daughters of an affected father and a carrier mother could have this condition. d) only if a woman is xxx could she have this condition.
Answers: 2
Biology, 22.06.2019 08:00, kajjumiaialome
Vaccines are weakened forms of disease causing microorganisms, which are given to patients to prevent disease. after the vaccine is administered, the immune system responds by creating a(n) to recognize the a.) antibody, antibiotic b.) antigen, antibody c.)antibiotic, antibody d.)antibody, antigen
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00, abronxtale02
Grade 91.)the gravitational pull from the moon words).2.) what is the rate of gravitational 3.)if you drop a hammer, is it more likely to drop handle side down, head side down, or equal chance that it will land either way? why? 4.)a car moves 60km east and 90km west. a.) what is the distance the car traveled? b.) what is the car's displacement5.)what is the average velocity of a car that moved 60 km south in 3 hours? 6.) a car starts from rest and acceleration to 60 m/s over a time of 5 seconds. what is the acceleration of the car? 7.)what is the speed of an object at rest?
Answers: 1
Explain how an mrna molecule directs the synthesis of a protein...
World Languages, 05.12.2020 06:30
Mathematics, 05.12.2020 06:30
Mathematics, 05.12.2020 06:30
History, 05.12.2020 06:30
Chemistry, 05.12.2020 06:30
History, 05.12.2020 06:30
History, 05.12.2020 06:30
Mathematics, 05.12.2020 06:30