![subject](/tpl/images/cats/biologiya.png)
Biology, 30.07.2019 08:00 nkazmirski3229
Organs, such as the stomach and the small and large intestines, are lined with smooth muscle tissue. these organs, due to the muscular contractions of their walls, involuntarily a) grind food into smaller pieces. b) move food through the digestive tract. c) add liquids to food to make it a slurry. d) supply digestive enzymes that aid in digestion.
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:00, elishaheart21
Which statement best describes the relationship between an allele and a gene? question 1 a. an allele is a variation of a gene that can be expressed as a phenotype. b. an allele is the part of a gene that attaches to messenger rna molecules. c. an allele is a segment of a dna molecule that controls replication of a gene.
Answers: 3
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:20, Yumimiku6539
Which organ controls breathing? lungs alveoli heart diaphragm
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 14:30, DeathFightervx
20 the main source of energy for our planet comes from the
Answers: 2
You know the right answer?
Organs, such as the stomach and the small and large intestines, are lined with smooth muscle tissue....
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
Mathematics, 17.09.2019 08:30
![Konu](/tpl/images/cats/en.png)
![Konu](/tpl/images/cats/biologiya.png)
Biology, 17.09.2019 08:30
![Konu](/tpl/images/cats/mat.png)
Mathematics, 17.09.2019 08:30
![Konu](/tpl/images/cats/en.png)
English, 17.09.2019 08:30
![Konu](/tpl/images/cats/health.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 17.09.2019 08:30
![Konu](/tpl/images/cats/istoriya.png)
History, 17.09.2019 08:30