Biology, 01.08.2019 12:00 seaotter9630
When a molecule of double-stranded dna undergoes replication, it results in a. one double-stranded dna molecule composed only of entirely new strands. b. three double-stranded dna molecules, each composed of sections of old and new strands. c. two double-stranded dna molecules, each composed of one new and one old strand. d. four double-stranded dna molecules, each composed only of old strands of dna?
Answers: 1
Biology, 22.06.2019 02:00, Aysha1311
Many farmers prefer cattle without horns because it is safer for their herds. the allele for no horns (n) is dominant to the allele for the presence of horns (n). a farmer mates a male with horns to a heterozygous female without horns. what is the chance that the offspring will have horns?
Answers: 1
Biology, 22.06.2019 11:30, RSanyuathey711
Suppose that on a small island off the coast of scotland, 32 percent of the population has blue eyes, which means that these individuals must be homozygous for the blue eye color gene (bb). the only other eye color found on the island is brown, and individuals that are homozygous for the brown eye color gene (bb) or heterozygous (bb) will have brown eyes because brown is the dominant gene. assume this population is in hardy-weinberg equilibrium. if 100 babies are born next year, how many of these would you expect to have brown eyes and be heterozygous? a. 58 b. 49 c. 29 d. 43
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
When a molecule of double-stranded dna undergoes replication, it results in a. one double-stranded d...
Mathematics, 04.05.2021 14:00
Geography, 04.05.2021 14:00
Physics, 04.05.2021 14:00