To which of the following dna sequences would the tata box binding protein bind? a. taggcgtatatagcgccttat b. cccgttaattaattaacgcgc c. gcgcttatctattaccgtacg d. atcgattccgatactatgcta

The mixture of sperm and fluids from the seminal vesicles, prostate gland, and cowper's glands is called

Label the following as inner or outer planets; a) has 67 moons made mostly of hydrogen and helium b) has rings c)no moons, high volcanic activity d) known as the red planet, has 2 moons e) very thin atmosphere, moons or rings

Forensic scientists think they know the identity of a skeleton. what rule should they use to select a relative whose dna could be used to try to confirm the identity?