subject
Biology, 23.07.2019 03:40 davisearron

The dose of an antigen that kills 50% of animals in a test group and is used to estimate the virulence of a pathogen is known as

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 23:40, elisameza
Which statement describes an endocrine function rather than an exocrine function? a. salivary glands release saliva into the mouth. b. sweat glands release sweat onto the skin c. the pineal gland releases melatonin into the blood. d. esophageal glands release mucus into the esophagus.
Answers: 1
image
Biology, 22.06.2019 03:30, sCoTtYbOy5329
What organelle other than the nucleus houses dna in a eukaryotic cell?
Answers: 1
image
Biology, 22.06.2019 09:20, recon12759
Amap's orientation is typically determined by an
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
The dose of an antigen that kills 50% of animals in a test group and is used to estimate the virulen...

Questions in other subjects:

Konu
Mathematics, 24.06.2019 23:40
Konu
English, 24.06.2019 23:40