subject
Biology, 20.07.2019 10:10 savannahckatz

What element is required for the building of molecules of atp and dna?

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 08:00, julielebo8
What is usually (but not always) related to the metabolic processes of living organisms in its organic form?
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 13:50, arrichardson787
The fluid mosaic model of the membrane proposed that membranes
Answers: 1
image
Biology, 22.06.2019 17:00, harvzoie
The function of the ciliary escalator is to
Answers: 1
You know the right answer?
What element is required for the building of molecules of atp and dna?...

Questions in other subjects:

Konu
Mathematics, 30.05.2021 14:40