subject
Biology, 15.07.2019 00:10 mcmccann4317

Which statement is true for both photosynthesis and cellular respiration? it occurs in consumers. it occurs in producers. it produces carbon dioxide. it produces oxygen.

ansver
Answers: 2

Other questions on the subject: Biology

image
Biology, 21.06.2019 18:30, gizmo50245
Which of the following are causes of coastal erosion? check all that apply. beach grasses and other plants trap windblown sand. wave action carves away the coastline. groundwater under pressure is forced to earth’s surface. artificial structures stop the natural flow of sand along the coast. underground caves collapse as bedrock is dissolved.
Answers: 1
image
Biology, 22.06.2019 00:50, scottkayce
Iguanas need to live in a habitat that is very warm, so the pet store warms their enclosures with "basking lights" which act as an artificial sun. describe how the three methods of thermal energy transfer may take place within the iguana's enclosure.
Answers: 3
image
Biology, 22.06.2019 08:30, williamsjamon0
Anormal appearing couple is found to be heterozygous recessive for albinism both have the genotype aa the gene responsible for albinism is recessive to the normal pigment-producing gene what are the changes of their children being albino
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Which statement is true for both photosynthesis and cellular respiration? it occurs in consumers. i...

Questions in other subjects:

Konu
Chemistry, 26.02.2021 20:50
Konu
Mathematics, 26.02.2021 20:50