![subject](/tpl/images/cats/biologiya.png)
Biology, 10.07.2019 22:50 vadrian4056
Which properties of minerals can we not accurately rely on because it can change even amongst the same mineral? question 1 options: luster streak color crystal structure
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:00, genesisramirezozfyj7
What molecules will be best used to compare different species with the exact same sequence of amino acids? why would two species have the same protein even if the molecules in question is different? (hint: transcription to translation to protein).
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, princessmoon
Which of the following is not associated with invasive species?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:30, laylay1734
How do the sperm cells get from the stigma to the ovules? a. they slide down the petals to the bottom of the flower. b. they travel through pollen tubes. c. they travel along filaments. d. insects carry the sperm cells from the stigma to the ovules.
Answers: 3
You know the right answer?
Which properties of minerals can we not accurately rely on because it can change even amongst the sa...
Questions in other subjects:
![Konu](/tpl/images/cats/geografiya.png)
Geography, 08.01.2021 01:00
![Konu](/tpl/images/cats/geografiya.png)
Geography, 08.01.2021 01:00
![Konu](/tpl/images/cats/biologiya.png)
Biology, 08.01.2021 01:00
![Konu](/tpl/images/cats/himiya.png)
Chemistry, 08.01.2021 01:00
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 08.01.2021 01:00
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/biologiya.png)
Biology, 08.01.2021 01:00