![subject](/tpl/images/cats/biologiya.png)
Biology, 03.07.2019 19:40 Lovergirl13
Why is the lining of your mouth stratified but the lining of your small intestine is not?
![ansver](/tpl/images/cats/User.png)
Answers: 1
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 17:00, HernanJe6
Which of the following statements is true of enzymes? a)they dont provide an active site for substrates to bind in a reaction b)they act on a specific type of substrate in a reaction c)they unusable after a reaction d)they change shape after a reaction
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 04:30, jesse7412
The picture showed normal blood cells which are around and sickle cells which appear much longer people with sickle-cell suffer from the sickle cell anemia which is inherited diseaseit is caused by a change in gene responsible for production of hemo goblin this type of change is known as an
Answers: 2
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Why is the lining of your mouth stratified but the lining of your small intestine is not?...
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/biologiya.png)
Biology, 11.12.2020 07:10
![Konu](/tpl/images/cats/mat.png)
Mathematics, 11.12.2020 07:10
![Konu](/tpl/images/cats/mat.png)
Mathematics, 11.12.2020 07:10
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 11.12.2020 07:10
![Konu](/tpl/images/cats/mat.png)
Mathematics, 11.12.2020 07:10
![Konu](/tpl/images/cats/istoriya.png)
History, 11.12.2020 07:10
![Konu](/tpl/images/cats/mat.png)