State disadvantage of mitosis

Which of the following statements regarding anfinsen's denaturing experiments with ribonuclease a (rnase a) are valid? exposing the denatured protein to air oxidation and then dialysis to remove urea restored the protein to its original functionality. removing urea by dialysis and then allowing air oxidation of the denatured protein restored the protein to its original functionality. denaturing the protein with both urea and β-mercaptoethanol yielded an inactive protein. anfinsen concluded that protein folding is determined by its primary sequence.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

The polio virus can cause skeletal muscle paralysis by destroying neuron cell bodies. what area of the spinal cord is destroyed