DNA message #2: GAGCGCACCATCGGGAAGCTA
Transcription:
Translation:

The return of the wolf to yellowstone national park will probably affect the bird population to some degree, not significantly. while wolves will hunt birds when necessary, they prefer to hunt larger prey. the bird population will most likely only be affected when hunting is scarce for the wolves. birds of prey will also probably not be affected as much as other birds who spend more time on the ground hunting for food as the tend to spend more time in the air or in trees since they do not need to stay on the ground for long due to the nature of the way they hunt.

Iwould say overuse ( but not 100% sure ) in the u.s. we tend to overuse water by leaving it running, throwing it away, taking long showers, etc.

Everything that you need in a lab is in your lab