![subject](/tpl/images/cats/biologiya.png)
Biology, 06.12.2021 08:40 sadsociety41
1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5'
Type of mutation ( 3pts):
Amino acid ( 3pts):
Type of mutation ( 3pts):
2. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACGCGCTTACGTCTGATCGCT 5'
Type of mutation ( 3pts):
Amino acid ( 3pts):
Type of mutation ( 3pts):
3. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' 5'
Type of mutation (3pts):
Amino acid ( 3pts):
Type of mutation ( 3pts):
4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' 5'
Type of mutation ( 3pts) :
Amino acid ( 3pts):
Type of mutation ( 3pts):
5. What is the difference between a point mutation and a frameshift mutation? 4pts
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 15:00, erica11223344
Once a woman attains puberty, her overuse mature and release one egg per ovarian cycle. which hormone stimulates this event?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 18:30, rebecca52360
What process allows for the development of haploid sex cells? mitosis meiosis fertilization pollination
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 22:00, lanaiheart7
The instructions for making proteins come originally from
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 23:00, akbogg3893
Based on the data in your tables, did the light-colored moths have a higher or lower survival rate after the industrial revolution?
Answers: 2
You know the right answer?
1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
Mutated DNA sequence: 3' TACATCCGCTTACGTCTGA...
Questions in other subjects:
![Konu](/tpl/images/cats/mat.png)
Mathematics, 10.09.2020 09:01
![Konu](/tpl/images/cats/mat.png)
Mathematics, 10.09.2020 09:01
![Konu](/tpl/images/cats/mat.png)
Mathematics, 10.09.2020 09:01
![Konu](/tpl/images/cats/geografiya.png)
Geography, 10.09.2020 09:01
![Konu](/tpl/images/cats/mat.png)
Mathematics, 10.09.2020 09:01
![Konu](/tpl/images/cats/mat.png)
Mathematics, 10.09.2020 09:01
![Konu](/tpl/images/cats/mat.png)
Mathematics, 10.09.2020 09:01
![Konu](/tpl/images/cats/mat.png)
Mathematics, 10.09.2020 09:01
![Konu](/tpl/images/cats/mat.png)
Mathematics, 10.09.2020 09:01
![Konu](/tpl/images/cats/mat.png)
Mathematics, 10.09.2020 09:01