Biology, 06.12.2021 08:40 sadsociety41

1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5'

Type of mutation ( 3pts):

Amino acid ( 3pts):

Type of mutation ( 3pts):

2. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mutated DNA sequence: 3' TACGCGCTTACGTCTGATCGCT 5'

Type of mutation ( 3pts):

Amino acid ( 3pts):

Type of mutation ( 3pts):

3. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mutated DNA sequence: 3' 5'

Type of mutation (3pts):

Amino acid ( 3pts):

Type of mutation ( 3pts):

4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mutated DNA sequence: 3' 5'

Type of mutation ( 3pts) :

Amino acid ( 3pts):

Type of mutation ( 3pts):

5. What is the difference between a point mutation and a frameshift mutation? 4pts

Answers: 2

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 19:30, womankrush538

Which statement is true about the cell theory? a) it is well-supported by evidence. b) it is unchangeable and permanent.

Answers: 2

continue

Biology, 21.06.2019 23:10, mohammedel04

Depending on the organism the number of in a cell may change

Answers: 1

continue

Biology, 22.06.2019 01:00, nahimo

In which terrestrial biome can you find trees that produce cones instead of flowers and needles instead of leaves? have trees that produce cones instead of flowers and needles instead of leaves. the latitudes in this biome have evenly distributed precipitation throughout the year. is it high or low

Answers: 2

continue

Biology, 22.06.2019 07:30, ebookhardt917

The picture represents a structure of the respiratory system. which is the function of this structure? to bring air into the body to exchange oxygen with carbon dioxide to carry air to the lungs to release oxygen from the body

Answers: 1

continue

You know the right answer?

1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACATCCGCTTACGTCTGA...