Biology, 04.12.2021 01:10 ElmerRamirez
Complete the following sentence. A farmer who uses geese to eat snails in his plant beds, has baited jars to capture flies near his barn, and hand-picks the June beetles from his roses has chosen to use biological and controls to deal with these pests
Answers: 2
Biology, 22.06.2019 09:00, veikkoaval
Dan made the table shown to describe two different relationships between animals. organism interactions relationship a relationship b one organism lives inside the organism it feeds off no organism is harmed which of the following statements is most likely correct?
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00, am2garcia5
14) whenever diploid populations are in hardy-weinberg equilibrium at a particular locus a) the allele's frequency should not change from one generation to the next, but its representation in homozygous and heterozygous genotypes may change. b) natural selection, gene flow, and genetic drift are acting equally to change an allele's frequency. c) this means that, at this locus, two alleles are present in equal proportions. d) the population itself is not evolving, but individuals within the population may be evolving.
Answers: 2
Biology, 22.06.2019 17:00, marioruiz7944
Which of the following do all living things have in common
Answers: 2
Complete the following sentence. A farmer who uses geese to eat snails in his plant beds, has baited...
Spanish, 21.07.2019 21:00
Physics, 21.07.2019 21:00
Biology, 21.07.2019 21:00
Geography, 21.07.2019 21:00
English, 21.07.2019 21:00