subject
Biology, 03.12.2021 21:20 sk9600930

Suppose a molecule that is too large to pass through a cell membrane on its own needs to exit a cell down its concentration gradient. What method of transport will be needed in order to accomplish this?

ansver
Answers: 3

Other questions on the subject: Biology

image
Biology, 21.06.2019 15:30, loraine4664
Which plant has a visible leaf modification that will it conserve water in extremely dry environments?
Answers: 1
image
Biology, 22.06.2019 00:00, nicolemaefahey
Hurry which of these is true about index fossils? a) are very scarcely found b) used as guides in relative dating c) found in the youngest layer of the rock d) used as reference points in absolute dating
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 12:10, ciara180
People with one sickle cell allele are not likely to get malaria. what is this an example of?
Answers: 1
You know the right answer?
Suppose a molecule that is too large to pass through a cell membrane on its own needs to exit a cell...

Questions in other subjects:

Konu
Mathematics, 21.04.2021 16:10
Konu
Mathematics, 21.04.2021 16:10
Konu
Arts, 21.04.2021 16:10
Konu
Mathematics, 21.04.2021 16:10