![subject](/tpl/images/cats/biologiya.png)
Select all the correct answers.
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The red letters are the noncoding region, and the black letters are the protein coding region.
ATTAGCATACTACGGGC
ATTTGCATACTGACCGGGC
ATTTGCAATACTACCGGGC
ATTTGCAACTACCGGGC
ATGAATGCATACTACCGGGC
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 16:00, mirianplacencia27
Lupe is a carrier for color blindness. her husband clifford is colorblind. if lupe and clifford have four children, what's the probability of a boy being colorblind?
Answers: 3
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 16:30, zamariahyou
How did the club fungi get its name? a. it is named for the club-shaped seeds it produces. b. it is named for the way individual species grow together in small groups called “clubs.” c. it is named for the club-shaped area where it produces spores. d. it is named for the club-like mechanism it uses to kill its prey.
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 17:00, maleja2038
Some species of wasps are social. the queen starts a colony from scratch each spring. she builds a small nest, and lays and raises a group of female workers. the workers enlarge the nest while the queen continues to lay eggs. unfertilized eggs become males that mate with newly hatched females. all of the wasps except the newly fertilized females die by the summer. which best describes this behavior? a)it is beneficial only to the males that do not fertilize eggs. b)it is beneficial only to the female workers that are not fertilized. c)it is beneficial to each one of the individual colony members. d)it is beneficial to the whole species, but not to all of the individual members.
Answers: 1
You know the right answer?
Select all the correct answers.
This sequence encodes for a particular protein that helps bacteria...
Questions in other subjects:
![Konu](/tpl/images/cats/himiya.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/istoriya.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 26.01.2021 18:30
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 26.01.2021 18:30
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 26.01.2021 18:30