subject
Biology, 27.10.2021 03:50 Jinesha

What questions can be answered by science? · If the question is asking about an or a , it cannot be measured using a scientific process.
· If the answer to the question cannot be and using a scientific process, it is not considered science.

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 05:30, pooch868
If a strand of dna has 35% thymine. what is the percentage of cytosine, adenine, guanine?
Answers: 3
image
Biology, 22.06.2019 10:00, diaamondz
Which process in respiration happens first? a)pyruvate processing b)electron transport chain c)krebs cycle d)glycolysis
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 16:30, legrandschool1oxa0sd
The offspring of a black cat and a white cat is a gray cat, it has the genotype bw if a black cat mates with a gray cat the chance that the offspring is white will be what percent?
Answers: 1
You know the right answer?
What questions can be answered by science? · If the question is asking about an or a , it cannot...

Questions in other subjects:

Konu
Mathematics, 29.11.2021 22:40