subject
Biology, 21.09.2021 04:40 sammamamam1090

Which statement describes an environmental benefit of the sustainable use of land? Sustainable farming of land can provide food to support a large global population.
Cutting down more trees will provide materials to build more affordable housing.
Problems associated with the degradation of common areas will decrease.
Companies will increase profits by dumping waste on public land.

ansver
Answers: 3

Other questions on the subject: Biology

image
Biology, 22.06.2019 01:00, leomessifanboy678
Why would a drug the damages capsids treat a viral infection
Answers: 1
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 12:00, princessmoon
Which of the following is not associated with invasive species?
Answers: 1
image
Biology, 22.06.2019 12:30, samv6390
Is becoming less expensive to screen blood samples for dna certain diseases have genetic basis what is possible ethical concern about the availability of inexpensive dna testing
Answers: 1
You know the right answer?
Which statement describes an environmental benefit of the sustainable use of land? Sustainable far...

Questions in other subjects: