subject
Biology, 19.09.2021 04:50 hannahe83

35 POINTS AND BRAINLIEST FOR PPL WHO GET IT RIGHT. CALCULATE: Imagine you have a five-step food chain. If 100 percent of the energy is available at the first trophic level, what percentage of energy is available at the highest trophic level? (SHOW WORK) Using your calculated numbers, explain why there is less BIOMASS at the top of the food chain.

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 21.06.2019 22:30, brandyleemom3
How can you approximate the number of calories required to keep you in energy balance?
Answers: 2
image
Biology, 22.06.2019 04:30, tk1264
What is the similarities and differences between bacteria and eukaryote?
Answers: 3
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
image
Biology, 22.06.2019 15:00, amunnik04
Cells control gene expression at which steps
Answers: 1
You know the right answer?
35 POINTS AND BRAINLIEST FOR PPL WHO GET IT RIGHT. CALCULATE: Imagine you have a five-step food ch...

Questions in other subjects:

Konu
Advanced Placement (AP), 19.09.2019 15:50