Biology, 07.09.2021 16:30 xxYingxYangxx7670
Why would a newborn that makes lactase be healthier than one who does not
Answers: 3
Biology, 21.06.2019 20:30, akamya21
Prior to the development of dna fingerprinting, blood type could be used to determine possible parentage. although it might prove someone was not a parent, it could not show if someone was positively the parent, only that he or she might be a parent. which of the following is a true statement that can be made about parentage based on blood typing?
Answers: 2
Biology, 21.06.2019 21:30, BigGirlsTheBest
Out of the seven main animal groups (fish, mammals, birds, insects, reptiles, amphibians, and arachnids), how many contain members with internal backbones? a. 5 b. 3 c. 7 d. 1
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:50, trishinada63
What do we call an individual that has inherited two identical alleles for the same trait? a. homozygous b. heterozygous c. monozzygous
Answers: 2
Why would a newborn that makes lactase be healthier than one who does not...
Mathematics, 27.07.2021 01:40
Mathematics, 27.07.2021 01:40