Biology, 30.08.2021 17:30 greend0719

What possible problems might be encountered by using only shells to
classify mollusks?

Answers: 1

Show answers

Other questions on the subject: Biology

Biology, 21.06.2019 19:00, ella3714

The hypothesis of continental drift states that earth's continents, which are located on tectonic plates, move relative to each other. which of the following is true of the movement of the tectonic plates? a. tectonic plates only move once every million years. b. they move at a rate of approximately 5 centimeters per year. c. tectonic plates never move, only the continents located on them do. d. their movements are very rapid and occur at random times.

Answers: 1

continue

Biology, 22.06.2019 00:20, ayoismeisjjjjuan

6. in domesticated cats, the following are independently assorting: normal ears (t) is dominant to tufted ears (t); curved whiskers (c) is dominant to straight whiskers (c); the presence of six toes (s) is dominant to five toes (s); gene for hair length is an x-linked codominant. the three phenotypes for hair length are long (xhxh), medium (xhxh), and short (xhxh); medium is the heterozygous condition. given two parents: ttccssxhxh x ttccssxhy how many different gametes could be formed in the female cat with respect to these four traits? how many phenotypes are possible in the offspring from this mating?

Answers: 1

continue

Biology, 22.06.2019 05:00, SmartScholar4094

Idon’t know the answer and i’ve been stuck on it for a while now skskskskks

Answers: 1

continue

Biology, 22.06.2019 12:00, jose200144

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?