![subject](/tpl/images/cats/biologiya.png)
Biology, 15.08.2021 17:10 0Brittany0
A man is diagnosed with the following symtoms: excessive urination, feeling of thirst and dehydration. What is he suffering from?
A. over secretion of vasopressin
B. over secretion of aldosterone
C. under secretion of vasopressin
D. under secretion of aldosterone
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Other questions on the subject: Biology
![image](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 22:00, lanaiheart7
The instructions for making proteins come originally from
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:20, AgarioEdit
The table lists the observations students made about four specimens under a microscope. based on these observations, what specimens did the students examine? animal plant virus prokaryote cell membrane present ribosomes present lysosomes present nuclear membrane present cell wall present ribosomes present nuclear membrane absent cell wall present ribosomes present nucleus present large vacuole present reproduces inside of a cell nucleus absent rna present 2019 edmentum all rights reserved intl
Answers: 2
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![image](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 13:00, Bradgarner772
"your temperature analysis reveals a pattern with coldest temperatures located to the portion of the map."
Answers: 1
You know the right answer?
A man is diagnosed with the following symtoms: excessive urination, feeling of thirst and dehydratio...
Questions in other subjects:
![Konu](/tpl/images/cats/en.png)
English, 19.05.2021 19:10
![Konu](/tpl/images/cats/ekonomika.png)
![Konu](/tpl/images/cats/ekonomika.png)
![Konu](/tpl/images/cats/User.png)
![Konu](/tpl/images/cats/informatica.png)
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 19.05.2021 19:10
![Konu](/tpl/images/cats/mat.png)
Mathematics, 19.05.2021 19:10
![Konu](/tpl/images/cats/mat.png)
![Konu](/tpl/images/cats/mat.png)
Mathematics, 19.05.2021 19:10