subject
Biology, 09.06.2021 17:30 timothyashburn8

How is a louse on a human head an example of parasitism?

(pls help i need fast!!)

ansver
Answers: 1

Other questions on the subject: Biology

image
Biology, 22.06.2019 03:50, ashleybarrera2000
Connection compare and contrast genetic engineering to the process of natural selection. select all statements that are true.
Answers: 1
image
Biology, 22.06.2019 05:40, rcherala
This group of organisms perform the process of ammonifcation. a. herbivores b. decomposers c. carnivores c. plants
Answers: 1
image
Biology, 22.06.2019 07:00, dlatricewilcoxp0tsdw
Which best describes a gene? a. a sister chromatid b. a chromosome c. a tetrad d. a piece of a chromosome
Answers: 2
image
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
How is a louse on a human head an example of parasitism?

(pls help i need fast!!)...

Questions in other subjects:

Konu
Physics, 16.02.2021 22:40
Konu
History, 16.02.2021 22:40