In a certain type of waterfowl, a single pair of alleles for one gene controls the color of feathers. Three colors are observed, blue, black, and splashed white (a silver color). Crosses among these three types yield the following results:
PARENTS
Black x blue
Black x splashed white
Blue x splashed white
Black x black
Splashed white x splashed white
PROGENY
Blue and Black 1:1
Blue
Blue and Splashed White 1:1
Black
Splashed White
(Lists are meant to go side by side)
1) What progeny would result from the cross blue x blue?
2) What mode of inheritance does this example represent?
Answers: 3
Biology, 22.06.2019 08:50, roneesmith2016
Why is earth's outer core hotter than earth’s oceanic crust? earth’s oceanic crust is denser than earth’s outer core is. earth’s oceanic crust has lava flowing from the mantle. earth’s outer core has a composition of solid iron and nickel. earth’s outer core is deeper within earth than oceanic crust is.
Answers: 1
Biology, 22.06.2019 12:00, jose200144
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 18:30, mdiaz487
Brian has a medical condition called cone dystrophy, which is a disorder of the cone cells in the eye. what symptoms would you expect brian to have? a. inability to see in the dark b. difficulty determining colors c. difficulty determining shapes and outlines d. inability to see in all light conditions
Answers: 2
In a certain type of waterfowl, a single pair of alleles for one gene controls the color of feathers...